POTENT INHIBITION OF INFLUENZA VIRUS BY SPECIFICALLY DESIGNED SHORT INTERFERING RNA

This patent application discloses siRNA sequences against the constant region of the influenza virus nucleoprotein gene comprising: Sense strand: 5' UGAAGGAUCUUAUUUCUUCdTdT 3' Anti sense strand: 3' dTdTACU UCCUAGAAU AAAGAAG 5' or Sense strand: 5' UGAAGGAUCUUAUUUCUUCGGdTdT 3&...

Full description

Saved in:
Bibliographic Details
Main Authors PAL, BIJAY, K, TRAN, LYNN, M
Format Patent
LanguageEnglish
French
Published 13.12.2007
Subjects
Online AccessGet full text

Cover

Loading…
More Information
Summary:This patent application discloses siRNA sequences against the constant region of the influenza virus nucleoprotein gene comprising: Sense strand: 5' UGAAGGAUCUUAUUUCUUCdTdT 3' Anti sense strand: 3' dTdTACU UCCUAGAAU AAAGAAG 5' or Sense strand: 5' UGAAGGAUCUUAUUUCUUCGGdTdT 3' Anti sense strand: 3' dTdTACUUCCUAGAAUAAAGAAGCC 5' or Sense strand: 5' GGAUCUUAUUUCUUCGGAGACdTdT 3' Anti sense strand: 3' dTdTCCUAGAAUAAAGAAGCCUCUG 5' said sequences being inhibitory against influenza virus in animals including humans. The invention further includes one or more of said siRNA sequences in the form of an aqueous suspension suitable for nasal inhalation. Still further, the invention includes one or more of said siRNA sequences in the form of a plasmid expressing intracellularly in animals including humans. In another aspect, the invention includes one or more of said siRNA sequences in the form of an AAV vector adapted to express intercellularly and establish a permanent inhibitory effect against influenza virus by integrating to the cellular chromosome of animals including humans. The invention also includes the administration to an animal including humans, in a therapeutically effective amount, at least one of said siRNA sequences. La présente invention concerne des séquences d'ARNsi dirigées contre la région constante du gène de la nucléoprotéine du virus de la grippe, comprenant : brin sens : 5' UGAAGGAUCUUAUUUCUUCdTdT 3' brin antisens : 3' dTdTACUUCCUAGAAU AAAGAAG 5' ou brin sens : 5' UGAAGGAUCUUAUUUCUUCGG dTdT 3' brin antisens : 3' dTdTACUUCCUAGAAUAAAGAAGCC 5' ou brin sens : 5' GGAUCUUAUUUCUUCGGAGACdTdT 3' brin antisens : 3' dTdTCCUAGAAUAAAGAAG CCUCUG 5', lesdites séquences inhibant le virus de la grippe chez les animaux, y compris l'homme. L'invention concerne en outre une ou plusieurs desdites séquences d'ARNsi sous la forme d'une suspension aqueuse adaptée à l'inhalation par voie nasale. L'invention concerne également une ou plusieurs desdites séquences d'ARNsi sous la forme d'un plasmide d'expression intracellulaire chez les animaux, y compris l'homme. Dans un autre aspect, l'invention concerne une ou plusieurs desdites séquences d'ARNsi sous la forme d'un vecteur AAV adapté pour l'expression intercellulaire et pour établir un effet permanent d'inhibition du virus de la grippe en l'intégrant dans le chromosome cellulaire d'animaux, y compris l'homme. L'invention concerne aussi l'administration d'une quantité thérapeutiquement efficace de l'une au moins desdites séquences d'ARNsi à un animal, y compris l'homme.
Bibliography:Application Number: WO2007US11741