Kit, useful for detecting Oligochaeta in a sample, comprises first pair of oligonucleotides and second pair of oligonucleotides, where the sample is collected in the environment such as soil, water and feces or matrices used in industry
Kit comprises a first pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SEQ ID NO. 5 and the second oligonucleotide hybridizes to the sequence of SEQ ID NO. 6 and a second pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SE...
Saved in:
Main Authors | , , , |
---|---|
Format | Patent |
Language | English French |
Published |
30.11.2012
|
Subjects | |
Online Access | Get full text |
Cover
Loading…
Summary: | Kit comprises a first pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SEQ ID NO. 5 and the second oligonucleotide hybridizes to the sequence of SEQ ID NO. 6 and a second pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SEQ ID NO. 7 and the second oligonucleotide hybridizes to the sequence of SEQ ID NO. 8, and the hybridization is carried out under stringency conditions sufficient for the amplification of a variable region of the mitochondrial 16S gene of Oligochaeta by PCR. Kit comprises a first pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SEQ ID NO. 5 (comprising aagctctatagggtcttcttg) and the second oligonucleotide hybridizes to the sequence of SEQ ID NO. 6 (comprising attcggttggggcgacc) and a second pair of oligonucleotides, where the first oligonucleotide hybridizes to the sequence of SEQ ID NO. 7 (comprising ggtcgccccaaccgaat) and the second oligonucleotide hybridizes to the sequence of SEQ ID NO. 8 (comprising aagctaccttagggataacag), and the hybridization is carried out under stringency conditions sufficient for the amplification of a variable region of the mitochondrial 16S gene of Oligochaeta by PCR. Independent claims are included for: (1) amplifying the region of the mitochondrial 16S gene of Oligochaeta, comprising (a) providing a sample containing DNA of Oligochaeta, and (b) carrying out the amplification reaction chain using the kit; (2) detecting Oligochaeta in the sample, comprising the step (a) as above per se, (ai) isolating total DNA in the sample, the step (b) as above per se, and (aii) detecting the possible presence of an amplification product; (3) the detection and identification of Oligochaeta in the sample, comprising the steps (a), (ai), (b) and (aii) as above per se and (e) determining the sequence of the amplification product for identifying the Oligochaeta contained in the sample; and (4) use of at least a portion of the region of the mitochondrial 16S gene of Oligochaeta corresponding to positions 11839-11907 or 11891-12002 of the mitochondrial 16S gene of Lumbricus terrestris(U24570) to detect and/or identify Oligochaeta.
La présente invention concerne des oligonucléotides et leur utilisation comme amorces universelles pour la détection et l'identification d'espèces oligochètes, notamment dans des substrats complexes et dégradés. La présente invention concerne également un procédé de détection et d'identification des espèces oligochètes dans des échantillons collectés dans l'environnement (sol, eau, fèces). |
---|---|
Bibliography: | Application Number: FR20110054615 |