Parotiditis virus fluorencent amplification detection reagent box and detection method

The invention offers detecting reagent boxes for fluorescent augment of mumps virus, which include hemagglutinin gene standards of mumps virus, detecting reagent of fluorescent augment, DNA polymerase and reverse transcriptase. The detecting reagent of fluorescent augment mainly contains buffer solu...

Full description

Saved in:
Bibliographic Details
Main Author YIYU,YAN LU
Format Patent
LanguageEnglish
Published 18.04.2007
Subjects
Online AccessGet full text

Cover

Loading…
More Information
Summary:The invention offers detecting reagent boxes for fluorescent augment of mumps virus, which include hemagglutinin gene standards of mumps virus, detecting reagent of fluorescent augment, DNA polymerase and reverse transcriptase. The detecting reagent of fluorescent augment mainly contains buffer solution of one-step RT-PCR, specificity exciters and probes, mixture of deoxidizing triphosphoric acid and nucleoside. The partial sequence of hemagglutinin gene standards of mumps virus is 5'- CTCAAGGACTGTTTGCCTCTTACACCACAACCACCTGCTTTCAAGATACCGGTGATGCTAGTG-3'. The specificity exciters have two sequences: the sequence of upstream exciters is 5'-CTCAAGGACTRTYTGCYTCSTA-3'and the sequence of downstream exciters is 5'-CTCTRGCAT CACCGGTATCTTGAA-3'. The equence of specificity probes is 5'-FAM-ACCACAACCACCTGC-NFQ-MGB-3', in which FAM is reporting fluorescent metakliny, NFQ is non-fluorescent annihilation metakliny, MGB is modifying metakliny. The detecting reagent boxes can detect pathogen nucleic acid directly. At the early stage of mumps disease, specificity gene of mumps virus can be detected, which facilitates early isolation, diagnosis and therapy.
Bibliography:Application Number: CN2006151828