Primer, reagent box and method for detecting staphylococcus aureus and mecA
The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liqu...
Saved in:
Main Authors | , , , , , , , |
---|---|
Format | Patent |
Language | English |
Published |
09.09.2015
|
Subjects | |
Online Access | Get full text |
Cover
Loading…
Summary: | The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate. |
---|---|
Bibliography: | Application Number: CN20151363950 |