Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with tr...

Full description

Saved in:
Bibliographic Details
Main Author CHANGMING,WU LU
Format Patent
LanguageEnglish
Published 22.08.2007
Subjects
Online AccessGet full text

Cover

Loading…
More Information
Summary:The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with transgenic rape Ms8Rf3 as material and primer pair MDB201, 5'GCTTGGACTATAATACCTGAC 3' and VDS57, 5' GCATGATCTGCTCGGGATGGC 3', and through PCR amplification. The present invention designs primers Ms8RG, 5'CCTTGAGGACGCTTTGATCATATT 3' and Ms8RV, 5'CCTTTTCTTATCGACCATGTACTC 3' and TaqMan probe Ms8RP, 5'FAM-CCGAGTTCGACGGCCGAGTACTG-TAMRA 3'; and establishes the specific quantitative and qualitative detection method of exogenous event inserting vector for transgenic rape Ms8. The present invention is suitable for specific PCR detection of other Ms8Rf3 event.
Bibliography:Application Number: CN2007151351