Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application
The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with tr...
Saved in:
Main Author | |
---|---|
Format | Patent |
Language | English |
Published |
22.08.2007
|
Subjects | |
Online Access | Get full text |
Cover
Loading…
Summary: | The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with transgenic rape Ms8Rf3 as material and primer pair MDB201, 5'GCTTGGACTATAATACCTGAC 3' and VDS57, 5' GCATGATCTGCTCGGGATGGC 3', and through PCR amplification. The present invention designs primers Ms8RG, 5'CCTTGAGGACGCTTTGATCATATT 3' and Ms8RV, 5'CCTTTTCTTATCGACCATGTACTC 3' and TaqMan probe Ms8RP, 5'FAM-CCGAGTTCGACGGCCGAGTACTG-TAMRA 3'; and establishes the specific quantitative and qualitative detection method of exogenous event inserting vector for transgenic rape Ms8. The present invention is suitable for specific PCR detection of other Ms8Rf3 event. |
---|---|
Bibliography: | Application Number: CN2007151351 |