Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

• Published in: International journal of laboratory hematology Vol. 39; no. 5; pp. 539 - 545
• Main Authors: Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
• Format: Journal Article
• Language: English
• Published: 01.10.2017
• ISSN: 1751-5521; 1751-553X
• DOI: 10.1111/ijlh.12692

Abstract Introduction Beta‐thalassemia (β‐thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. Methods One hundred and forty‐nine β‐thal Mexican mestizo patients were studied (154 alleles). ARMS ‐ PCR was performed to identify Cd39C>T, IVS 1:1G>A, IVS 1:110G>A, ‐28A>C, initiation codonA>G and IVS 1:5G>A mutations, and gap‐ PCR for δβ‐thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Results Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: ‐90C>G, 20 bp deletion (at codons 78/85), and IVS 2:2T>G; the mutation IVS 1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS 1:1G>A (17.3%), IVS 1:110G>A (13.9%), and δβ‐thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Conclusion Considering the novel mutations ‐90C>G, ‐20 bp Cd78/85, IVS 2:2T>G and the first observation of IVS 1:6T>C, the molecular spectrum of β‐thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.