Contrasting effects of Al and A2b adenosine receptors on adipogenesis

• Published in: International Journal of Obesity Vol. 36; no. 3; p. 397
• Main Authors: Gharibi, B, Abraham, A.A, Ham, J, Evans, B.A.J
• Format: Journal Article
• Language: English
• Published: Nature Publishing Group 01.03.2012
• Subjects: Adenosine; Hormone receptors; Insulin resistance; Physiological aspects; United Kingdom
• ISSN: 0307-0565; 1476-5497
• DOI: 10.1038/ijo.2011.129

Background: Adenosine mediates its actions through four G protein-coupled receptors, A1, A2a, A2b and A3. The A1 receptor (A1R) is dominant in adipocytes where it mediates many actions that include inhibition of lipolysis, stimulation of leptin secretion and protection against obesity-related insulin resistance. Objective: The objective of this study is to investigate whether induced expression of A1Rs stimulates adipogenesis, or whether A1R expression is a consequence of cells having an adipocyte phenotype. Methodology: Human A1R and A2b receptors (A2bRs) were stably transfected into a murine osteoblast precursor cell line, 7F2. Adipogenesis was determined by lipid accumulation and expression of adipocyte and osteoblast marker molecules. Adenosine receptor expression and activation of associated signal molecules were also evaluated as 7F2 cells were induced to differentiate to adipocytes. Results: 7F2 cells transfected with the A1R showed increased adipocyte marker mRNA expression; lipoprotein lipase and glycerol-3-phosphate dehydrogenase were both upregulated, whereas the osteoblast marker alkaline phosphatase (ALP) was downregulated. When cultured in adipocyte differentiating media, such cells also showed increased adipogenesis as judged by lipid accumulation. Conversely, A2bR transfection stimulated osteocalcin and ALP expression, and in addition, adipogenesis was inhibited in the presence of adipocyte differentiation media. Adipogenic differentiation of naive 7F2 cells also resulted in increased expression of the A1R and reduced or modified expression of the A2a and A2bR. The loss of A2 receptors after adipogenic differentiation was accompanied by a loss of cyclic adenosine monophosphate and ERK1/2 signalling. Conclusion: These data show that expression of A1Rs induced adipocyte differentiation, whereas A2bR expression inhibited adipogenesis and stimulated an osteoblastic phenotype. These data suggest that targeting A1 and A2bR could be considered in the management of obesity and diabetes. Targeting adenosine signal pathways may be useful in treatment strategies for diseases in which there is an imbalance between osteoblasts and adipocytes. International Journal of Obesity (2012) 36, 397-406; doi: 10.1038/ijo.2011.129; published online 5 July 2011 Keywords: adenosine; A1 receptor; A2b receptor; 7F2; 3T3L1; adipogenesis TTGGCTATCCAGGCTTGTTC TTTGGAAGGTGGATTTCCTG