Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

• Published in: Endocrinology (Philadelphia) Vol. 147; no. 9; pp. 4292 - 4302
• Main Authors: Hashimoto, Koshi, Yamada, Masanobu, Matsumoto, Shunichi, Monden, Tsuyoshi, Satoh, Teturou, Mori, Masatomo
• Format: Journal Article
• Language: English
• Published: Bethesda, MD Endocrine Society 01.09.2006
• Subjects: Animals; Base Sequence; Biological and medical sciences; Carcinoma, Hepatocellular; Cell Line; Cell Line, Tumor; Cercopithecus aethiops; Down-Regulation - drug effects; Fundamental and applied biological sciences. Psychology; Gene Deletion; Gene Expression Regulation - drug effects; Humans; Kidney; Liver - chemistry; Liver Neoplasms; Male; Mice; Mice, Inbred C57BL; Molecular Sequence Data; Mutagenesis; Promoter Regions, Genetic - genetics; Receptors, Thyroid Hormone - metabolism; Response Elements - genetics; Retinoid X Receptors - metabolism; Reverse Transcriptase Polymerase Chain Reaction; RNA, Messenger - analysis; Sterol Regulatory Element Binding Protein 1 - genetics; Transcription, Genetic - drug effects; Transfection; Triiodothyronine - pharmacology; Vertebrates: endocrinology; Binding protein; Vertebrata; Mammalia; Mouse; Animal; Rodentia; Lipids; Thyroid hormone; Gene expression; Response element; Sterol
• ISSN: 0013-7227; 1945-7170
• DOI: 10.1210/en.2006-0116

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.