Disrupted N-linked glycosylation as a disease mechanism in deficiency of ADA2

• Published in: Journal of allergy and clinical immunology Vol. 142; no. 4; pp. 1363 - 1365.e8
• Main Authors: Lee, Pui Y., Huang, Yuelong, Zhou, Qing, Schnappauf, Oskar, Hershfield, Michael S., Li, Ying, Ganson, Nancy J., Sampaio Moura, Natalia, Delmonte, Ottavia M., Stone, Scellig S., Rivkin, Michael J., Pai, Sung-Yun, Lyons, Todd, Sundel, Robert P., Hsu, Victor W., Notarangelo, Luigi D., Aksentijevich, Ivona, Nigrovic, Peter A.
• Format: Journal Article
• Language: English
• Published: United States Elsevier Inc 01.10.2018; Elsevier Limited
• Subjects: Adenosine; Adenosine Deaminase - blood; Adenosine Deaminase - deficiency; Adenosine Deaminase - genetics; Agammaglobulinemia - blood; Agammaglobulinemia - genetics; Child, Preschool; Enzymes; Female; Glycosylation; Humans; Intercellular Signaling Peptides and Proteins - blood; Intercellular Signaling Peptides and Proteins - deficiency; Intercellular Signaling Peptides and Proteins - genetics; Ketoglutaric acid; Laboratories; Leukocytes (eosinophilic); Microscopy; Mutagenesis; Mutation; Proteins; Severe Combined Immunodeficiency - blood; Severe Combined Immunodeficiency - genetics; Software
• ISSN: 0091-6749; 1097-6825; 1097-6825
• DOI: 10.1016/j.jaci.2018.05.038

[...]T129 and the preceding N127 together constitute a consensus N-linked glycosylation sequence (NXS/T) required for the attachment of oligosaccharides.6 N-glycosylation has well-recognized roles in protein folding, trafficking, and function.7 Confirming the presence of N-glycosylation at N127, substituting this residue with glutamine (N127Q) recapitulated the shift in MW and impaired secretion as seen with the T129P mutation (Fig 1, H). Protein sequence alignment was performed using COBALT (Constraint-based Multiple Alignment Tool).E7ADA2 activity assay The patient was initially shown to be deficient in plasma ADA2 enzymatic activity by testing performed at Duke University using 2 independent assays: a screening spectrophotometric assay that couples the release of ammonia from adenosine with the consumption of β-Nicotinamide adenine dinucleotide catalyzed by glutamic dehydrogenase in the presence of α-ketoglutarate E8,E9 (as modified by N.J. Ganson, S.J. Kelly, M.S. Hershfield, unpublished data, 2014) and a somewhat more sensitive HPLC-based method to directly quantify the conversion of adenosine to inosine (as described in Zhou et al,E4 but performed in 100 mM Tris-acetate buffer, pH 7.0, instead of phosphate buffer). Age of patient 2 y 1 mo 2 y 5 mo 2 y 8 mo 4 y 3 mo Treatment Pretreatment Tocilizumab Etanercept Etanercept Duration — 2 mo 2 mo 18 mo Weight percentile for age 7 12 34 66 Reference range WBC (k cells/μL) 5.9-10.8 10.6 6.9 6.8 5.9 % Neutrophil 30-73 70 59 55 45 % Lymphocyte 11-59 22 33 30 36 % Monocyte 4-8 4 4 14 18 % Eosinophil 1-4 1 1 0 1 Hemoglobin (g/dL) 11.1-12.9 8.2 10.9 9.5 11.7 Platelet (k cells/μL) 208-410 681 190 267 245 AST (U/L) 2-40 31 61 46 40 ALT (U/L) 3-30 10 22 13 18 ESR (mm/h) 1-20 69 2 7 4 CRP (mg/dL) <0.50 16.8 <0.03 0.22 <.03 IgG (mg/dL) 400-1300 672 417 780 1,051 IgM (mg/dL) 30-120 32 20 46 77 IgA (mg/dL) 20-230 39 36 24 69 Antinuclear antibodies Negative Negative Negative Lymphocyte panel CD3+ % 49-84 60 CD3+ (cells/μL) 1900-6200 2792 CD3+ CD4+ % 28-52 44 CD3+ CD4+ (cells/μL) 1300-3400 2060 CD3+ CD8+ % 13-30 14 CD3+ CD8+ (cells/μL) 620-2000 647 CD19+ % 13-37 35 CD19+ (cells/μL) 620-2600 1618 CD3− CD16+/CD56+ % 3-15 5 CD3− CD16+/CD56+ (cells/μL) 160-1100 221 Serum cytokines (pg/mL) Il-2 ≤22 <5 IL-2 receptor ≤1033 1383 IL-12 ≤5 <5 IFN-γ ≤5 <5 IL-4 ≤5 <5 IL-5 ≤5 <5 IL-10 ≤18 7 IL-13 ≤5 <5 IL-1 beta ≤36 <5 IL-6 ≤5 24 IL-8 ≤5 <5 TNF-α ≤5 <5 Table E1 Laboratory parameters during the subject's clinical course. Substitution Forward Reverse P129T (reversion) TCACCTACAGGCCTCACTGCC CATTCCTCACCAGCCAGTCCATAG N127Q TCACCTACAGGCCTCACTGCC CTTGCCTCACCAGCCAGTCCATAG N174Q GCGGGTGCAGCAGGTCACTGAGT TTCCGATAATCCTCCAGCAG N185Q AGCTTGCTGAGGCAGTTCACTCTGG GTCATCAAACTCAGTGACGTTC N378Q CTACCAGAATCGGCCATGGATTTG TCTGCAGCATCAGAGCATCCAGAAT I480T CATGAACTCTACCAAGTACAGTACCC GCCAGCTGTTTGAGGGTC K481N ACTCTATCAATTACAGTACCCTGTTG TCATGGCCAGCTGTTTGA Table E2 Primers used for site-directed mutagenesis Variant in CECR1 Type Consequence Effect on NXS/T sequence Allele count Alleleic frequency PolyPhen2 prediction SIFT prediction 22:17688123 T/A (rs547716532) Missense p.Asn127Ile Loss 3 1.22 × 10−05 Possibly damaging Deleterious 22:17688123 T/C (rs547716532) Missense p.Asn127Ser Loss 1 4.06 × 10−06 Probably damaging Deleterious 22:17684647 T/G (rs752890414) Missense p.Thr187Pro Loss 1 4.07 × 10−06 Probably damaging Deleterious 22:17663594 G/A (rs765154508) Missense p.Thr380Ile Loss 2 8.12 × 10−06 Probably damaging Deleterious 22:17663595 T/C Missense p.Thr380Ala Loss 1 3.23 × 10−05 Possibly damaging Deleterious 22:17662713 A/G Missense p.Ile480Thr Gain 1 3.22 × 10−05 Probably damaging Deleterious 22:17662466 C/A (rs774795047) Missense p.Lys481Asn Gain 4 1.62 × 10−05 Benign Deleterious 22:17688116 G/A Synonymous p.Thr129Thr None 2 8.12 × 10−06 NA NA 22:17687981 G/A (rs746651975) Synonymous p.Asn174Asn None 4 1.63 × 10−05 NA NA 22:17687980 C/T (rs757839578) Missense p.Val175Ile None 1 4.06 × 10−06 Benign Tolerated 22:17687980 C/A (rs757839578) Missense p.Val175Phe None 1 4.06 × 10−06 Benign Deleterious 22:17687975 A/T Synonymous p.Thr176Thr None 1 4.06 × 10−06 NA NA 22:17687975 A/G Synonymous p.Thr176Thr None 1 4.06 × 10−06 NA NA 22:17684651 A/G (rs758525993) Synonymous p.Asn185Asn None 8 3.26 × 10−05 NA NA 22:17663599 G/A (rs763728425) Synonymous p.Asn378Asn None 1 4.06 × 10−06 NA NA 22:17663598 T/C (rs561591791) Missense p.Thr379Ala None 10 4.06 × 10−05 Benign Tolerated 22:17663598 T/A (rs561591791) Missense p.Thr379Ser None 2 8.12 × 10−06 Benign Tolerated 22:17663596 A/T Synonymous p.Thr379Thr None 1 4.06 × 10−06 NA NA Table E3 Variants in gnomAD database affecting ADA2 glycosylation sites