Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines

• Published in: Journal of Integrative Agriculture Vol. 18; no. 12; pp. 2835 - 2843
• Main Authors: ZHOU, Zheng-wei, CAO, Guo-hua, LI, Zhe, HAN, Xue-jie, LI, Chen, LU, Zhen-yu, ZHAO, Yu-hang, LI, Xue-ling
• Format: Journal Article
• Language: English
• Published: Elsevier B.V 01.12.2019; State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science,Inner Mongolia University,Hohhot 010070,P.R.China; Elsevier
• Subjects: CRISPR/Cas9; gRNA; off-target rate; targeting site; targeting site; CRISPR/Cas9; off-target rate; gRNA
• ISSN: 2095-3119; 2352-3425
• DOI: 10.1016/S2095-3119(19)62744-9

The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.