The meningococcal autotransporter AutA is implicated in autoaggregation and biofilm formation
Summary Autotransporters (ATs) are proteins secreted by Gram‐negative bacteria that often play a role in virulence. Eight different ATs have been identified in Neisseria meningitidis, but only six of them have been characterized. AutA is one of the remaining ATs. Its expression remains controversial...
Saved in:
| Published in | Environmental microbiology Vol. 17; no. 4; pp. 1321 - 1337 |
|---|---|
| Main Authors | , , , , , , |
| Format | Journal Article |
| Language | English |
| Published |
England
Blackwell Publishing Ltd
01.04.2015
Wiley Subscription Services, Inc |
| Subjects | |
| Online Access | Get full text |
Cover
Loading…
| Summary: | Summary
Autotransporters (ATs) are proteins secreted by Gram‐negative bacteria that often play a role in virulence. Eight different ATs have been identified in Neisseria meningitidis, but only six of them have been characterized. AutA is one of the remaining ATs. Its expression remains controversial. Here, we show that the autA gene is present in many neisserial species, but its expression is often disrupted by various genetic features; however, it is expressed in certain strains of N. meningitidis. By sequencing the autA gene in large panels of disease isolates and Western blot analysis, we demonstrated that AutA expression is prone to phase variation at AAGC nucleotide repeats located within the DNA encoding the signal sequence. AutA is not secreted into the extracellular medium, but remains associated with the bacterial cell surface. We further demonstrate that AutA expression induces autoaggregation in a process that, dependent on the particular strain, may require extracellular DNA (eDNA). This property influences the organization of bacterial communities like lattices and biofilms. In vitro assays evidenced that AutA is a self‐associating AT that binds DNA. We suggest that AutA‐mediated autoaggregation might be particularly important for colonization and persistence of the pathogen in the nasopharynx of the host. |
|---|---|
| Bibliography: | Netherlands Organization for Health Research and Development (ZonMw) - No. 91206083 istex:B36577DE34B021AEE7727F9C1CF10ED1962C91CE ArticleID:EMI12581 Fig. S1. Genetic context and organization of the autA gene in various Neisseria strains. A. Comparison of the autA loci in the genome sequences of N. meningitidis strains MC58 and α153, N. lactamica strain 020-06, N. gonorrhoeae strain NCCP11945 and N. flavescens strain NRL30031/H210. Numbers at the side of each map indicate the first and last nucleotide position of the DNA fragment shown in accordance with genome annotations, and locus tags are provided. The (pseudo)genes (arrows) and intergenic regions (lines) with high sequence similarity are coloured identically in the different genomes. The gene upstream of autA (coloured red) is conserved in most neisserial genomes; it may encode a hypothetical protein of 81 aa, but in some strains an upstream-located start codon is assigned resulting in a larger protein. The gene downstream of autA (coloured green) is also well conserved and encodes a predicted outer membrane protein (annotated as OmpU in some genomes) involved in the colonization of the nasopharyngeal mucosa (Exley et al., 2009). In NRL30031/H210, the autA gene is flanked upstream by the mdaB gene (NEIFLAOT_02052) encoding a modulator of drug activity B; its homologue in MC58 is NMB1857. The gene downstream of autA (pale blue) encodes a hypothetical cytosolic protein, uniquely found in N. flavescens and N. subflava. Interestingly, the genes further upstream and downstream of the locus (NEIFLAOT_02053 and NEIFLAOT_02046, respectively) are homologous to the genes NMB2133 and the 3′ end of NMB2134 respectively. These genes are contiguous in the genome of MC58, suggesting that a DNA segment containing autA gene and the flanking genes was inserted in block in this region in N. flavescens. In this process, the 5′ end of the gene corresponding to NMB2134 was apparently lost. It is noteworthy that NMB2134 is homologous to tamA of E. coli, which was reported to be involved in AT secretion (Selkrig et al., 2012). Sequences 127 bp upstream and 366 bp downstream of autA are preserved in all the different genomic contexts, suggesting that these regions are co-transferred. Examination of these regions revealed sequences for a putative promoter and transcription terminator (see panel B), indicating that the gene is monocistronic. The 127 bp upstream region contains sequences of 47 and 26 bp in length that are variably repeated in direct and inverted orientation further upstream in all species except in N. flavescens. A blast search revealed the presence of multiple copies of these repeats all along the meningococcal chromosomes. These sequences share over 90% identity with known RS3 palindromic sequences. They are present, for example, upstream and downstream of the porA gene, where they are implicated in the loss of this gene in certain isolates via recombination (van der Ende et al., 1999). The coding region of the autA gene is segmented in three regions encoding the signal sequence (coloured solid black), the passenger domain (open striped) and the β-barrel domain at the 3′ end. In all genomes shown, the autA gene is out of frame because of the number of AAGC repeats in the signal-sequence-encoding region, and some of the genes are further disrupted by a well-conserved premature stop codon located in the same part (indicated by red slashes). Some of the genes contain various (additional) stop codons in the proper reading frame along the gene, i.e. in α153, NCCP11945 and NRL30031/H210 (not indicated for clarity reasons). In N. meningitidis α153, the autA gene contains an insertion of a transposable element of 843 bp (coloured blue) in the passenger domain. An insertion of the same element is also present in the autA genes of strains NM255 and NM2657 but at a different position as in α153, reflecting that they arose from an independent insertion events. In N. gonorrhoeae, the autA gene suffers a deletion of 983 nucleotides (indicated by discontinuous lines). B. Relevant genetic elements in the autA gene in MC58. The relative positions of the predicted -35 box (TTGCGA), Pribnow box (TATAAT), ribosome-binding site (RBS) (AGGA), start codon, AAGC repeat region (black bar), premature stop codon (red slash), stop codon and the transcription terminator sequences (ACCGGCAGTTTCCCGCCGGT) are indicated at the bottom relative to the start codon (above the line) and according with coordinates of the MC58 genome sequence (beneath the line). The positions of the start codon annotated by Ait-Tahar and colleagues (2000) (ATG*), cleavage site for signal peptidase, and start and end of the passenger domain are also provided. The fragment of the passenger-encoding domain that was expressed for raising antiserum is indicated by a grey line.Fig. S2. Alignment of the predicted mature AutA in various N. meningitidis strains. Numbers above the alignment indicate amino-acid positions according with the full-length sequence of MC58 AutA obtained when the gene is in frame and the premature stop codon is deleted. Asterisks, colons and periods below the sequences indicate identical amino acids in all aligned sequences, and positions with conserved and semi-conserved substitutions respectively. The start and end of the AutA segment that was used to raise antiserum are indicated.Fig. S3. Analysis of autoaggregation in N. meningitidis. Suspensions from overnight cultures of strains HB-1, BB-1 and α14were adjusted to the same OD550 and left standing. The OD550 at the top of the tube was determined each 2 h.Table S1. Identification and characterization of the autA gene in available Neisseria genome sequences. Homologues were identified in a BLASTnt search using as query the sequence encoding the AutA passenger domain of MC58. The gene locus, position on chromosome, number of tetranucleotide repeats in the 5′ region and the resulting in/out phase are given.Table S2. Primers used in this study. Restriction sites used for cloning are indicated and underlined.Table S3. Determination of the number of AAGC-repeat units in the autA gene of invasive isolates of Neisseria meningitidis.Video Clip Biofilm formation of strain HB-1ΔautA carrying pFPAutA cultured in TSB medium without (Video Clip S1) or with IPTG (Video Clip S2) developed under flow systems. ark:/67375/WNG-BCP7VDD1-3 ObjectType-Article-1 SourceType-Scholarly Journals-1 ObjectType-Feature-2 content type line 23 |
| ISSN: | 1462-2912 1462-2920 |
| DOI: | 10.1111/1462-2920.12581 |