Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra -Containing Products

• Published in: Molecules (Basel, Switzerland) Vol. 27; no. 7; p. 2342
• Main Authors: Wang, Gang, Bai, Xuanjiao, Chen, Xiaochen, Ren, Ying, Han, Jianping
• Format: Journal Article
• Language: English
• Published: Switzerland MDPI AG 06.04.2022; MDPI
• Subjects: Alkaloids - metabolism; Chromatography; Deoxyribonucleic acid; Dietary supplements; DNA; DNA barcoding; Ephedra; Ephedra - genetics; Ephedra - metabolism; Ephedrine; Ephedrine - metabolism; ephedrine alkaloids; Herbal medicine; Herbs; Humans; Methamphetamine; nucleotide signature; Nucleotides; Plant Extracts; Poisons; Supervision; Beijing China; United States > US; China; ephedrine alkaloids; nucleotide signature; methamphetamine; Ephedra; DNA barcoding; supervision
• ISSN: 1420-3049; 1420-3049
• DOI: 10.3390/molecules27072342

plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore materials are strictly in supervision internationally. However, unlawful utilization of herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to and conserved within the genus. It can be successfully utilized for the detection of components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of -containing products.