Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

• Published in: Human genomics Vol. 17; no. 1; pp. 111 - 5
• Main Authors: Bao, Xiuqin, Qin, Danqing, Wang, Jicheng, Chen, Jing, Yao, Cuize, Liang, Jie, Liang, Kailing, Wang, Yixia, Wang, Yousheng, Du, Li, Yin, Aihua
• Format: Journal Article
• Language: English
• Published: England BioMed Central 08.12.2023; BMC
• Subjects: Automation; beta-Globins - genetics; beta-Thalassemia - genetics; Bibliometrics; Blood diseases; China; Female; Gene deletion; Hematology; Hemoglobin; Humans; Mutation; Novel mutations; Peptides; Pregnancy; Premature termination; Prenatal Diagnosis; Sequence Deletion - genetics; Thalassemia; Truncated peptide; β-Thalassemia; β-Thalassemia trait; China; Guangdong China; β-Thalassemia trait; β-Thalassemia; Novel mutations; Premature termination; Truncated peptide
• ISSN: 1479-7364; 1473-9542; 1479-7364
• DOI: 10.1186/s40246-023-00559-4

β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.