BoviPure® density-gradient centrifugation procedure enhances the quality of fresh and cryopreserved dog epididymal spermatozoa
Galarza, D.A., Jara, D.I., Paredes, E.B., Samaniego, J.X., Méndez, M.S., Soria, M.E., Perea, F., Muñoz-León, E., Santiago-Moreno, J.
Published in Animal reproduction science (01.07.2022)
Published in Animal reproduction science (01.07.2022)
Get full text
Journal Article
Planning rapid transit networks
Laporte, G., Mesa, J.A., Ortega, F.A., Perea, F.
Published in Socio-economic planning sciences (01.09.2011)
Published in Socio-economic planning sciences (01.09.2011)
Get full text
Journal Article
Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women
González-Mercado, A, Sánchez-López, J Y, Regla-Nava, J A, Gámez-Nava, J I, González-López, L, Duran-Gonzalez, J, Celis, A, Perea-Díaz, F J, Salazar-Páramo, M, Ibarra, B
Published in Genetics and molecular research (30.07.2013)
Published in Genetics and molecular research (30.07.2013)
Get full text
Journal Article
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2)
de-la-Cruz-Salcedo, E I, Ibarra, B, Rizo-de-la-Torre, L C, Sánchez-López, J Y, González-Mercado, A, Harteveld, C L, Perea-Díaz, F J
Published in International journal of laboratory hematology (01.10.2016)
Published in International journal of laboratory hematology (01.10.2016)
Get full text
Journal Article
β-globin gene cluster haplotypes in sickle cell patients from Panamá
Rusanova, Iryna, Cossio, Gladys, Moreno, Bélgica, Javier Perea, F., De Borace, Rosaura G., Perea, Mauricio, Escames, Germaine, Acuña-Castroviejo, Darío
Published in American journal of human biology (01.05.2011)
Published in American journal of human biology (01.05.2011)
Get full text
Journal Article
Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
A combination of positive tumor HLA-I and negative PD-L1 expression provides an immune rejection mechanism in bladder cancer
Flores Martín, J., Salas Moreno, M.C., Ramos Alaminos, C.I., Perea, F., Expósito-Ruiz, M., Javier Carretero, F., Rodríguez, T., Villamediana Abad, M., Ruiz-Cabello, F., Garrido, F., Cózar-Olmo, J.M., Moreno Jiménez, J., Aptsiauri, N.
Published in European urology open science (Online) (01.07.2020)
Published in European urology open science (Online) (01.07.2020)
Get full text
Journal Article
Modeling cooperation on a class of distribution problems
Perea, F., Puerto, J., Fernández, F.R.
Published in European journal of operational research (01.11.2009)
Published in European journal of operational research (01.11.2009)
Get full text
Journal Article
Discoloration of Indigo Carmine Using Aqueous Extracts from Vegetables and Vegetable Residues as Enzyme Sources
Pérez, H. I., Manjarrez, N., Solís, M., Perea, F., Solís, A., Cassani, J.
Published in BioMed research international (01.01.2013)
Published in BioMed research international (01.01.2013)
Get full text
Journal Article
RACE AND CONSTITUTIONAL LAW CASEBOOKS: RECOGNIZING THE PROSLAVERY CONSTITUTION
Get full text
Book Review
Journal Article
I only have eyes for you: Ovulation redirects attention (but not memory) to attractive men
Anderson, Uriah S., Perea, Elaine F., Vaughn Becker, D., Ackerman, Joshua M., Shapiro, Jenessa R., Neuberg, Steven L., Kenrick, Douglas T.
Published in Journal of experimental social psychology (01.09.2010)
Published in Journal of experimental social psychology (01.09.2010)
Get full text
Journal Article
EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population
Torres-Jasso, J H, Marín, M E, Santiago-Luna, E, Leoner, J C, Torres, J, Magaña-Torres, M T, Perea, F J, Ibarra, B, Sánchez-López, J Y
Published in Genetics and molecular research (13.03.2015)
Published in Genetics and molecular research (13.03.2015)
Get full text
Journal Article
Lunar Cycle Influences Production of Tilapia ( Oreochromis spp) Eggs in an Intensive Outdoor Production System in the Tropics
Perea, Miguel F, Perdomo, Daniel A, Corredor, Zenaida A, González, Mario, Hernandez-Fonseca, Hugo, Perea, Fernando P
Published in Journal of biological rhythms (01.04.2022)
Published in Journal of biological rhythms (01.04.2022)
Get more information
Journal Article
Field evaluation of a decision support system for herbicidal control of Avena sterilis ssp. ludoviciana in winter wheat
GONZALEZ-ANDUJAR, J.L, FERNANDEZ-QUINTANILLA, C, BASTIDA, F, CALVO, R, GONZALEZ-DIAZ, L, IZQUIERDO, J, LEZAUN, J.A, PEREA, F, SANCHEZ DEL ARCO, M.J, URBANO, J.M
Published in Weed research (01.02.2010)
Published in Weed research (01.02.2010)
Get full text
Journal Article
The moon cycle influences reproductive and productive traits in guinea pigs ( Cavia porcellus ) from a tropical Andean area
Perea, Miguel F, Fernández, Estefanía A, Garzón, Juan P, Rosales, Cornelio A, Hernández-Fonseca, Hugo, Perdomo, Daniel A, Perea, Fernando P
Published in Chronobiology international (2024)
Published in Chronobiology international (2024)
Get full text
Journal Article
Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family
Tintos-Hernández, J A, Perea, F J, Ibarra, B, Figuera, L E
Published in West Indian medical journal (01.01.2012)
Get more information
Published in West Indian medical journal (01.01.2012)
Journal Article