Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population
Torres-Jasso, J H, Marín, M E, Santiago-Luna, E, Leoner, J C, Torres, J, Magaña-Torres, M T, Perea, F J, Ibarra, B, Sánchez-López, J Y
Published in Genetics and molecular research (13.03.2015)
Published in Genetics and molecular research (13.03.2015)
Get full text
Journal Article
Dup-24 bp in the CHIT1 Gene in Six Mexican Amerindian Populations
Da Silva-José, T. D., Juárez-Rendón, K. J., Juárez-Osuna, J. A., Porras-Dorantes, A., Valladares-Salgado, A., Cruz, M., Gonzalez-Ibarra, M., Soto, A. G., Magaña-Torres, M. T., Sandoval-Ramírez, L., García-Ortiz, José Elías
Published in JIMD Reports, Volume 23 (01.01.2015)
Published in JIMD Reports, Volume 23 (01.01.2015)
Get full text
Book Chapter
Journal Article
Association between the CDH1-472delA and -160C>A polymorphisms and diffuse and intestinal gastric cancer in a Mexican population
Bustos-Carpinteyro, A R, Delgado-Figueroa, N, Santiago-Luna, E, Magaña-Torres, M T, Sánchez-López, J Y
Published in Genetics and molecular research (16.09.2016)
Published in Genetics and molecular research (16.09.2016)
Get full text
Journal Article
The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer
Vázquez-Ibarra, K C, Bustos-Carpinteyro, A R, García-Ruvalcaba, A, Magaãa-Torres, M T, Gutiérrez-Aguilar, R, Marín-Contreras, M E, Santiago-Luna, E, Sánchez-López, J Y
Published in Brazilian journal of medical and biological research (01.01.2019)
Published in Brazilian journal of medical and biological research (01.01.2019)
Get full text
Journal Article
Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
A new complex chromosomal translocation t(2;12;21)(q33;p13;q22) in B-cell acute lymphoblastic leukemia
Vasquez-Jimenez, E.A., Romo-Martínez, E.J., Meza-Espinoza, J.P., Lopez-Guido, B., Magaña-Torres, M.T., Gonzalez-Garcia, J.R.
Published in Cancer genetics and cytogenetics (15.07.2006)
Published in Cancer genetics and cytogenetics (15.07.2006)
Get full text
Journal Article
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients
Rizo-de-la-Torre, L C, Ibarra, B, Sanchez-Lopez, J Y, Magana-Torres, M T, Renteria-Lopez, V M, Perea-Diaz, F J
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
A new complex chromosomal translocation t(2;12;21)(q33;p13;q22) in B-cell acute lymphoblastic leukemia
Vasquez-Jimenez, E A, Romo-Martínez, E J, Meza-Espinoza, J P, Lopez-Guido, B, Magaña-Torres, M T, Gonzalez-Garcia, J R
Published in Cancer genetics and cytogenetics (15.07.2006)
Get full text
Published in Cancer genetics and cytogenetics (15.07.2006)
Report