Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients
Rizo-de-la-Torre, L C, Ibarra, B, Sanchez-Lopez, J Y, Magana-Torres, M T, Renteria-Lopez, V M, Perea-Diaz, F J
Published in International journal of laboratory hematology (01.10.2017)
Published in International journal of laboratory hematology (01.10.2017)
Get full text
Journal Article